ID: 1201419459_1201419467

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1201419459 1201419467
Species Human (GRCh38) Human (GRCh38)
Location Y:13782468-13782490 Y:13782504-13782526
Sequence CCACCCAGTTTGAACTTCCTTGC TACTCAAGCCTGGGCAATGGCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!