ID: 1201447002_1201447005

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1201447002 1201447005
Species Human (GRCh38) Human (GRCh38)
Location Y:14068225-14068247 Y:14068259-14068281
Sequence CCAACAGACTTAAAATAAGACTC AATAACTTCTCTAACATATTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 40, 4: 320}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!