ID: 1201496414_1201496425

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1201496414 1201496425
Species Human (GRCh38) Human (GRCh38)
Location Y:14594861-14594883 Y:14594886-14594908
Sequence CCCCATGATCTGAGTCAAGGTCC GTGGGGATCCGTACTGGGGATGG
Strand - +
Off-target summary {0: 65, 1: 76, 2: 71, 3: 49, 4: 113} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!