ID: 1201555099_1201555102

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1201555099 1201555102
Species Human (GRCh38) Human (GRCh38)
Location Y:15259002-15259024 Y:15259024-15259046
Sequence CCTTTCTAATCCTTCAAGTGCAT TGAAGCATTATATAAGGAAAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!