ID: 1201602717_1201602722

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1201602717 1201602722
Species Human (GRCh38) Human (GRCh38)
Location Y:15748690-15748712 Y:15748705-15748727
Sequence CCCTGGACTGACCTGCTGGCTCT CTGGCTCTTTGAGTGGCCTAGGG
Strand - +
Off-target summary {0: 2, 1: 16, 2: 21, 3: 95, 4: 336} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!