ID: 1201648868_1201648878

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1201648868 1201648878
Species Human (GRCh38) Human (GRCh38)
Location Y:16264079-16264101 Y:16264125-16264147
Sequence CCTCCAGATTTTGTTCAGGTCCC CCTGATATCTGTGGCTGATTGGG
Strand - +
Off-target summary No data {0: 56, 1: 61, 2: 80, 3: 50, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!