ID: 1201650997_1201650998

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1201650997 1201650998
Species Human (GRCh38) Human (GRCh38)
Location Y:16286390-16286412 Y:16286420-16286442
Sequence CCTGTTAAATGCTGCATGTTCTG TCTTTAACAGTCTTACATTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 171} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!