ID: 1201653931_1201653936

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1201653931 1201653936
Species Human (GRCh38) Human (GRCh38)
Location Y:16321175-16321197 Y:16321201-16321223
Sequence CCCAATCAGCCACAGATATCAGG AAGCTCCAAAAGTGAGCCCTGGG
Strand - +
Off-target summary No data {0: 51, 1: 49, 2: 101, 3: 49, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!