ID: 1201653934_1201653941

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1201653934 1201653941
Species Human (GRCh38) Human (GRCh38)
Location Y:16321184-16321206 Y:16321221-16321243
Sequence CCACAGATATCAGGAGAAAGCTC GGGACCTGAACAAAATCTGGAGG
Strand - +
Off-target summary {0: 75, 1: 53, 2: 28, 3: 36, 4: 224} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!