ID: 1201658876_1201658880

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1201658876 1201658880
Species Human (GRCh38) Human (GRCh38)
Location Y:16378827-16378849 Y:16378859-16378881
Sequence CCTTGAAGATTACTCAGTCTTTA CAAAATGCTGGTGGTGTTACTGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 6, 3: 43, 4: 322}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!