ID: 1201668931_1201668936

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1201668931 1201668936
Species Human (GRCh38) Human (GRCh38)
Location Y:16493256-16493278 Y:16493271-16493293
Sequence CCAGACTTTGGGTACCCTACGGA CCTACGGATGGTGTTGAGGCTGG
Strand - +
Off-target summary No data {0: 3, 1: 16, 2: 23, 3: 18, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!