ID: 1201677439_1201677443

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1201677439 1201677443
Species Human (GRCh38) Human (GRCh38)
Location Y:16603247-16603269 Y:16603287-16603309
Sequence CCCATTAGCAAAGACCAAGCTTC ATTGCCCATCTGTAATATCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 95} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!