ID: 1201719156_1201719157

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1201719156 1201719157
Species Human (GRCh38) Human (GRCh38)
Location Y:17078159-17078181 Y:17078175-17078197
Sequence CCTGCACAGTGGAGACACAGGGA ACAGGGAGCATGTCCTGCACAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!