ID: 1201755651_1201755655

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1201755651 1201755655
Species Human (GRCh38) Human (GRCh38)
Location Y:17483286-17483308 Y:17483302-17483324
Sequence CCTTGCCTCATTTGGTTCCCAGT TCCCAGTTAGGGTTCTCATTTGG
Strand - +
Off-target summary {0: 2, 1: 5, 2: 5, 3: 13, 4: 226} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!