ID: 1201756742_1201756750

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1201756742 1201756750
Species Human (GRCh38) Human (GRCh38)
Location Y:17494435-17494457 Y:17494456-17494478
Sequence CCTGATCCTGTTCCTCCTGACTG TGGGCAAGACCTCCCAAAAGGGG
Strand - +
Off-target summary {0: 29, 1: 75, 2: 164, 3: 242, 4: 628} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!