ID: 1201760901_1201760909

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1201760901 1201760909
Species Human (GRCh38) Human (GRCh38)
Location Y:17537086-17537108 Y:17537135-17537157
Sequence CCTTCAGTCATTGTGCTCTTCCT CTGTGTGGCTGCTGCTGGGTGGG
Strand - +
Off-target summary No data {0: 2, 1: 3, 2: 13, 3: 44, 4: 547}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!