ID: 1201763351_1201763356

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1201763351 1201763356
Species Human (GRCh38) Human (GRCh38)
Location Y:17560591-17560613 Y:17560609-17560631
Sequence CCCTGTCTTGCACAAAGGTTGTG TTGTGTGTCTCGCCCTCAGGGGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 1, 3: 13, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!