ID: 1201763438_1201763450

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1201763438 1201763450
Species Human (GRCh38) Human (GRCh38)
Location Y:17560917-17560939 Y:17560967-17560989
Sequence CCCGGCGCAGGGGCCGCCAGGAA GCCTCGAGGTTGTTTTCCCCGGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 11, 3: 52, 4: 257} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!