ID: 1201763765_1201763773

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1201763765 1201763773
Species Human (GRCh38) Human (GRCh38)
Location Y:17562243-17562265 Y:17562293-17562315
Sequence CCTCCTGAGGGCGAGATGCACAC ACACCGCCAGGACCGGCGCAGGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 0, 3: 3, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!