ID: 1201765801_1201765804

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1201765801 1201765804
Species Human (GRCh38) Human (GRCh38)
Location Y:17572653-17572675 Y:17572679-17572701
Sequence CCTGCCATTATCTGCAGATAACC CTTTCTATCCAGCTAGCCTCTGG
Strand - +
Off-target summary {0: 5, 1: 1, 2: 23, 3: 234, 4: 298} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!