ID: 1201788334_1201788342

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1201788334 1201788342
Species Human (GRCh38) Human (GRCh38)
Location Y:17809219-17809241 Y:17809256-17809278
Sequence CCATGTATCTTCAGAACAGGAAG GTCTCCAGGAGGGGCAGGATGGG
Strand - +
Off-target summary No data {0: 4, 1: 1, 2: 3, 3: 49, 4: 331}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!