ID: 1201796915_1201796924

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1201796915 1201796924
Species Human (GRCh38) Human (GRCh38)
Location Y:17905917-17905939 Y:17905967-17905989
Sequence CCACCACAGTCTCTGCTGAAAGC AGTGAGGAGCTACCCACTCGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!