ID: 1201838197_1201838207

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1201838197 1201838207
Species Human (GRCh38) Human (GRCh38)
Location Y:18345381-18345403 Y:18345427-18345449
Sequence CCCCCTGAGGGCGAGACACACAA AGGGCCCCCCAGCCCGCCGCAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 2, 3: 27, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!