ID: 1201848594_1201848603

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1201848594 1201848603
Species Human (GRCh38) Human (GRCh38)
Location Y:18451378-18451400 Y:18451427-18451449
Sequence CCAAACGCAATCTCCTGGTCTGC CATTTTAGGCACAGGGTGCATGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 89, 3: 404, 4: 555} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!