ID: 1201870781_1201870788

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1201870781 1201870788
Species Human (GRCh38) Human (GRCh38)
Location Y:18705168-18705190 Y:18705196-18705218
Sequence CCCTAAAAAACTGGCCCTCCCAC ATTTGTAATATGAAGATGCAGGG
Strand - +
Off-target summary {0: 3, 1: 5, 2: 15, 3: 21, 4: 124} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!