ID: 1201904591_1201904602

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1201904591 1201904602
Species Human (GRCh38) Human (GRCh38)
Location Y:19076653-19076675 Y:19076679-19076701
Sequence CCCCTCGGCAGCCCCTCACAGCA CCCGGGCTCCCAGAACCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 300} {0: 1, 1: 1, 2: 3, 3: 41, 4: 379}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!