ID: 1201929643_1201929651

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1201929643 1201929651
Species Human (GRCh38) Human (GRCh38)
Location Y:19328297-19328319 Y:19328349-19328371
Sequence CCATATGTGAAAACCTACCAAAT GTGCCAGAGGTCCCCCACAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 243} {0: 1, 1: 0, 2: 3, 3: 10, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!