ID: 1202028601_1202028611

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1202028601 1202028611
Species Human (GRCh38) Human (GRCh38)
Location Y:20551023-20551045 Y:20551073-20551095
Sequence CCTTCTTCGGTCTCCCTCTGTTG GGACTGTATTGCCGTGGTCTCGG
Strand - +
Off-target summary {0: 4, 1: 1, 2: 8, 3: 113, 4: 225} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!