ID: 1202116650_1202116652

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1202116650 1202116652
Species Human (GRCh38) Human (GRCh38)
Location Y:21475446-21475468 Y:21475460-21475482
Sequence CCTTAGTCCATTTGTTTTCATGC TTTTCATGCTATTGAGTTGTTGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 15, 3: 19, 4: 239} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!