ID: 1202133521_1202133526

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1202133521 1202133526
Species Human (GRCh38) Human (GRCh38)
Location Y:21636068-21636090 Y:21636103-21636125
Sequence CCTAAACATGTTCAAAGACAGAA CTCTGGGGCTCTCCAGTTTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 14, 3: 115, 4: 429}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!