ID: 1202168777_1202168779

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1202168777 1202168779
Species Human (GRCh38) Human (GRCh38)
Location Y:22019133-22019155 Y:22019164-22019186
Sequence CCTCTTTTAAAATTCATGGGTCA AAACCTGCTACACCAAACCAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!