ID: 1202177820_1202177825

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1202177820 1202177825
Species Human (GRCh38) Human (GRCh38)
Location Y:22113863-22113885 Y:22113876-22113898
Sequence CCTACCTGGGAGACTGCAATCCT CTGCAATCCTGGGGAAAAAATGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 39, 4: 327} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!