ID: 1202230758_1202230764

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1202230758 1202230764
Species Human (GRCh38) Human (GRCh38)
Location Y:22655132-22655154 Y:22655176-22655198
Sequence CCTGTGTTTGCTAGATAATTCCC TAGCAGTATTCTTTGATGATAGG
Strand - +
Off-target summary No data {0: 4, 1: 8, 2: 9, 3: 11, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!