ID: 1202270222_1202270230

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1202270222 1202270230
Species Human (GRCh38) Human (GRCh38)
Location Y:23065064-23065086 Y:23065097-23065119
Sequence CCTGCAGGTGCATGCCACCACGG TTGGGGGTTTTTGTAGAGACAGG
Strand - +
Off-target summary No data {0: 4, 1: 1, 2: 63, 3: 1334, 4: 25175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!