ID: 1202318811_1202318816

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1202318811 1202318816
Species Human (GRCh38) Human (GRCh38)
Location Y:23610126-23610148 Y:23610145-23610167
Sequence CCTTCTTTAAGATTACCAACTTT CTTTCCTTGCTGGAGATGGAGGG
Strand - +
Off-target summary No data {0: 4, 1: 0, 2: 3, 3: 37, 4: 358}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!