ID: 1202339657_1202339663

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1202339657 1202339663
Species Human (GRCh38) Human (GRCh38)
Location Y:23849760-23849782 Y:23849811-23849833
Sequence CCTGCAGGGGCAACAGTGAAGTT CAAGCTGATAAAATTGCTATTGG
Strand - +
Off-target summary {0: 3, 1: 3, 2: 0, 3: 26, 4: 258} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!