ID: 1202358290_1202358297

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1202358290 1202358297
Species Human (GRCh38) Human (GRCh38)
Location Y:24074976-24074998 Y:24075010-24075032
Sequence CCACCACAGTATCTGCTGAAAGC TGGGATGACCAGCTAGAGTGAGG
Strand - +
Off-target summary No data {0: 4, 1: 0, 2: 9, 3: 69, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!