ID: 1202358328_1202358332

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1202358328 1202358332
Species Human (GRCh38) Human (GRCh38)
Location Y:24075251-24075273 Y:24075288-24075310
Sequence CCACTCTAAAGCCGTCTCTCCAC TCATCAGAACATCCAGCCTGTGG
Strand - +
Off-target summary No data {0: 6, 1: 0, 2: 2, 3: 21, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!