ID: 1202367280_1202367282

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1202367280 1202367282
Species Human (GRCh38) Human (GRCh38)
Location Y:24174062-24174084 Y:24174086-24174108
Sequence CCAAGTCTGCGGCAGCAGCAAGA CAGTACCTGTGTACCGCTCTAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 8, 3: 22, 4: 139} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!