ID: 1202374163_1202374174

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1202374163 1202374174
Species Human (GRCh38) Human (GRCh38)
Location Y:24218190-24218212 Y:24218242-24218264
Sequence CCTGTGGTGATTGGCAAGGGCAA CTGACTGAGAAGACTTTGGTGGG
Strand - +
Off-target summary No data {0: 3, 1: 7, 2: 17, 3: 37, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!