ID: 1202377514_1202377522

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1202377514 1202377522
Species Human (GRCh38) Human (GRCh38)
Location Y:24250617-24250639 Y:24250653-24250675
Sequence CCCTGTAGGACTCCATATGGGGC ATGATAACAGGGTGTAAGTCAGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 0, 3: 6, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!