ID: 1202377515_1202377521

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1202377515 1202377521
Species Human (GRCh38) Human (GRCh38)
Location Y:24250618-24250640 Y:24250642-24250664
Sequence CCTGTAGGACTCCATATGGGGCC GATGGCAGGATATGATAACAGGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 1, 3: 9, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!