ID: 1202379029_1202379040

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1202379029 1202379040
Species Human (GRCh38) Human (GRCh38)
Location Y:24260540-24260562 Y:24260566-24260588
Sequence CCCTGGAAGGGAGACCCCCACCC TCTGCAGGCCCACATGACTCAGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 1, 3: 22, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!