ID: 1202445096_1202445111

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1202445096 1202445111
Species Human (GRCh38) Human (GRCh38)
Location Y:24950237-24950259 Y:24950276-24950298
Sequence CCGGGGCTGCTCCCGGCGCTTGC CGGGTGGGTGTGGGCTTGGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!