ID: 1202491740_1202491752

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1202491740 1202491752
Species Human (GRCh38) Human (GRCh38)
Location Y:25409553-25409575 Y:25409580-25409602
Sequence CCCCTGAGTCATGTGGGCCTGCA GGGGTGGGGGTCTCCCTTCCAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 1, 3: 19, 4: 172} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!