ID: 1202531104_1202531109

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1202531104 1202531109
Species Human (GRCh38) Human (GRCh38)
Location Y:25820305-25820327 Y:25820322-25820344
Sequence CCACTAAAGAAACCCCCAACTTC AACTTCACTGTTGCCCCTGCAGG
Strand - +
Off-target summary No data {0: 3, 1: 3, 2: 0, 3: 26, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!