ID: 1202541942_1202541946

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1202541942 1202541946
Species Human (GRCh38) Human (GRCh38)
Location Y:25947075-25947097 Y:25947092-25947114
Sequence CCATTTTCCTTAAGTGTTGGTTG TGGTTGGTCTCAGAAATAAAGGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 52, 3: 146, 4: 391}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!