ID: 1202544358_1202544369

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1202544358 1202544369
Species Human (GRCh38) Human (GRCh38)
Location Y:25974709-25974731 Y:25974760-25974782
Sequence CCAAGATTTGGAATGTCCCAGGT CCCAGTGGGTACCCCGAATCTGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 1, 3: 11, 4: 151} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!