ID: 1202704853_1202704864

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1202704853 1202704864
Species Human (GRCh38) Human (GRCh38)
Location 1_KI270713v1_random:15114-15136 1_KI270713v1_random:15166-15188
Sequence CCCGGCTGGTGGAGGGACAGCTG GCCCCCGGCCCGCGACAACCCGG
Strand - +
Off-target summary No data {0: 3, 1: 2, 2: 0, 3: 17, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!