ID: 1202704900_1202704905

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1202704900 1202704905
Species Human (GRCh38) Human (GRCh38)
Location 1_KI270713v1_random:15282-15304 1_KI270713v1_random:15296-15318
Sequence CCACAGTGCCCACAGCGCCCCCA GCGCCCCCAGCCCTGGGACGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!